Top » Catalog » SNPs » A423

$18.00

A423
[A423]

A423
hg38 Position: ChrY:12049167..12049167
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A423v2_F AGTTTCCATATCCTGAGGATTTTATG
Reverse Primer: A423v2_R CTAACAAATTCCCAGGTGATGC
Reviews

Customers who bought this product also purchased
FGC23112
FGC23112
FGC23103
FGC23103
A712
A712
A682
A682
Z16840
Z16840
A420
A420
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies