Top » Catalog » SNPs » A425

$18.00

A425
[A425]

A425
hg38 Position: ChrY:15987662..15987662
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF5 > A426 > A1344
Forward Primer: A425_F GCAGCAGCACTTACGAATTTC
Reverse Primer: A425_R CATGAAGTATAGTATGGAAAACCAATC
Reviews

Customers who bought this product also purchased
FGC28340
FGC28340
A712
A712
A682
A682
A421
A421
Z16840
Z16840
A420
A420
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies