Top » Catalog » SNPs » DF27

$18.00

DF27
[DF27]

DF27
hg38 Position: ChrY:19218314..19218314
Ancestral: G
Derived: A
Reference: Andy Gierson
ISOGG Haplogroup: R1b1a1a2a1a2a
Comments: downstream of P312 and parent of Z196 and Z225/Z229
Forward Primer: DF27_F GGGAATTTGATCCTGTCGTTG DF27nested_F TATTTTATTTCTCCTTCACTTATA
Reverse Primer: DF27_R GAACAAAGCCTCCAAGAAATATGAGG DF27nested_R ATCCAGGAGAACTTCCCCAATC
Reviews

Customers who bought this product also purchased
Z367
Z367
L2
L2
DF41
DF41
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Z56
Z56
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x YSEQ-Gamma
1 x YSEQ-Beta
1 x mtComplete
1 x HVR2
1 x HVR1
1 x mtUpgrade
$483.00
Haplogroup Info
Other products
Currencies