Top » Catalog » SNPs » DF27

$18.00

DF27
[DF27]

DF27
hg38 Position: ChrY:19218314..19218314
Ancestral: G
Derived: A
Reference: Andy Gierson
ISOGG Haplogroup: R1b1a1a2a1a2a
Comments: downstream of P312 and parent of Z196 and Z225/Z229
Forward Primer: DF27_F GGGAATTTGATCCTGTCGTTG DF27nested_F TATTTTATTTCTCCTTCACTTATA
Reverse Primer: DF27_R GAACAAAGCCTCCAAGAAATATGAGG DF27nested_R ATCCAGGAGAACTTCCCCAATC
Reviews

Customers who bought this product also purchased
Y31384
Y31384
Y34174
Y34174
S355
S355
Y134723
Y134723
Y5049
Y5049
BY15479
BY15479
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies