Top » Catalog » SNPs » DF27

$18.00

DF27
[DF27]

DF27
hg38 Position: ChrY:19218314..19218314
Ancestral: G
Derived: A
Reference: Andy Gierson
ISOGG Haplogroup: R1b1a1a2a1a2a
Comments: downstream of P312 and parent of Z196 and Z225/Z229
Forward Primer: DF27_F GGGAATTTGATCCTGTCGTTG DF27nested_F TATTTTATTTCTCCTTCACTTATA
Reverse Primer: DF27_R GAACAAAGCCTCCAAGAAATATGAGG DF27nested_R ATCCAGGAGAACTTCCCCAATC
Reviews

Customers who bought this product also purchased
BY25512
BY25512
Z195
Z195
CTS1751
CTS1751
FGC13748
FGC13748
BY20463
BY20463
DF63
DF63
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies