Top » Catalog » SNPs » Z16266

$18.00

Z16266
[Z16266]

Z16266
hg38 Position: ChrY:21391369..21391369
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: downstream of DF21
Forward Primer: Z16266_F CCTAAAAAAGACTGTGAGACTGGG
Reverse Primer: Z16266_R CCCTCATAAATAGCCTGGCTG
Reviews

Customers who bought this product also purchased
R1b-DF21 Panel
R1b-DF21 Panel
FGC23380
FGC23380
S7858
S7858
Z3004
Z3004
A58
A58
A50
A50
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies