Top » Catalog » SNPs » Z16837

$18.00

Z16837
[Z16837]

Z16837
hg38 Position: ChrY:12892530..12892530
Ancestral: T
Derived: G
Reference: Gregory Magoon et al. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: downstream of DF21
Forward Primer: Z16837_F TTTTCCATGATCCCTCCATC
Reverse Primer: Z16837_R GATGCATGTGAGAGGAGTGC
Reviews

Customers who bought this product also purchased
A682
A682
A712
A712
A423
A423
A385
A385
A422
A422
A459
A459
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies