Top » Catalog » SNPs » BY16788

$18.00

BY16788
[BY16788]

BY16788
hg38 Position: ChrY:20448678..20448678
Ancestral: G
Derived: C
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY16788_F ATAGAAATAACAGATTTCGGTGATCG
Reverse Primer: BY16788_R CCTTTCCTGAGATGGCAAAAG
Reviews

Customers who bought this product also purchased
CTS4466
CTS4466
CTS114
CTS114
BY16787
BY16787
Wish a SNP
Wish a SNP
BY16789
BY16789
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies