Top » Catalog » SNPs » FGC5254

$18.00

FGC5254
[FGC5254]

FGC5254
hg38 Position: ChrY:7949620..7949620
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a6a
Comments: Downstream FGC5264
Forward Primer: FGC5254_F CCATTCCAGAGAGCAGAGTAATG
Reverse Primer: FGC5254_R GAGTGATGTGGAATCTCCTGC
Reviews

Customers who bought this product also purchased
Z8
Z8
FGC1967
FGC1967
R1b-L48 Panel
R1b-L48 Panel
FGC17517
FGC17517
BY20804
BY20804
Z11
Z11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies