Top » Catalog » SNPs » FGC5254

$18.00

FGC5254
[FGC5254]

FGC5254
hg38 Position: ChrY:7949620..7949620
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a6a
Comments: Downstream FGC5264
Forward Primer: FGC5254_F CCATTCCAGAGAGCAGAGTAATG
Reverse Primer: FGC5254_R GAGTGATGTGGAATCTCCTGC
Reviews

Customers who bought this product also purchased
FGC17517
FGC17517
BY20804
BY20804
Z11
Z11
BY13828
BY13828
Z344
Z344
S24411
S24411
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies