Top » Catalog » SNPs » FT375808

$18.00

FT375808
[FT375808]

FT375808
hg38 Position: ChrY:16436727..16436727
Ancestral: C
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT375808_F TGCATGCAAATGACTCTGTTC
Reverse Primer: FT375808_R CAGGCATCCTTGCAATCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies