Top » Catalog » SNPs » BY16790

$18.00

BY16790
[BY16790]

BY16790
hg38 Position: ChrY:21827731..21827731
Ancestral: C
Derived: T
Reference: FTDNA (2017)
ISOGG Haplogroup: R
Comments: .
Forward Primer: BY16790_F CCCAGAGACCCCTCAACG
Reverse Primer: BY16790_R AAAGACTCAACCCTACTATGTCTAGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies