Top » Catalog » SNPs » FT209620

$18.00

FT209620
[FT209620]

FT209620
hg38 Position: ChrY:12493663..12493663
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT209620_F CTTAAACCCATAGAACCCTTCTCAC
Reverse Primer: FT209620_R CCTCACGCTGCAATCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies