Top » Catalog » SNPs » FT375111

$18.00

FT375111
[FT375111]

FT375111
hg38 Position: ChrY:2991131..2991131
Ancestral: T
Derived: G
Reference: FTDNA (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT375111_F GTTGGTGTATAGGAATGCTAGCAG
Reverse Primer: FT375111_R CAGCATTAGATAAAAAAGCTAATTAATCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A22571
$18.00
Haplogroup Info
Other products
Currencies