Top » Catalog » SNPs » Y175429

$18.00

Y175429
[Y175429]

Y175429
hg38 Position: ChrY:11426901..11426901
Ancestral: T
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: J1
Comments: Below FGC11 > Y5321 > FGC23914
Forward Primer: Y175429_F CATTGTGGAAGTCAATGTGGAG
Reverse Primer: Y175429_R GAAGGGGCTCTTCTCCCA
Reviews

Customers who bought this product also purchased
FT160581
FT160581
FGC1715
FGC1715
A17831
A17831
ZS5804
ZS5804
A13637
A13637
FGC1713
FGC1713
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies