Top » Catalog » SNPs » Y175429

$18.00

Y175429
[Y175429]

Y175429
hg38 Position: ChrY:11426901..11426901
Ancestral: T
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: J1
Comments: Below FGC11 > Y5321 > FGC23914
Forward Primer: Y175429_F CATTGTGGAAGTCAATGTGGAG
Reverse Primer: Y175429_R GAAGGGGCTCTTCTCCCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies