Top » Catalog » SNPs » A427

$18.00

A427
[A427]

A427
hg38 Position: ChrY:21120043..21120043
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: I2a2a1b1a1a
Comments: Below P78 > S25733. Aka Y4889
Forward Primer: A427_F CAAGTCAGGGATGTCATTCAAC
Reverse Primer: A427_R CATCAGTCTCCCCTGCATC
Reviews

Customers who bought this product also purchased
I2a-CTS10100 Panel
I2a-CTS10100 Panel
A1818
A1818
Y5367
Y5367
S10309
S10309
S25733
S25733
Y4893
Y4893
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies