Top » Catalog » SNPs » S24930

$19.00

S24930
[S24930]

S24930
hg38 Position: ChrY:20799128..20799128
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J1
Comments: Below Z643 > Z2324 > Y3081 > Y3088
Forward Primer: S24930_F AGGTGATCACGCTCCCTG
Reverse Primer: S24930_R GGTCAAACAAGAATCCTTTAATAACG
Reviews

Customers who bought this product also purchased
Z18271
Z18271
P58
P58
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies