Top » Catalog » SNPs » Z6065

$18.00

Z6065
[Z6065]

Z6065
hg38 Position: ChrY:16070426..16070426
Ancestral: G
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: J2a1a2a1
Comments: Approx. L267
Forward Primer: Z6065_F CACTTTCCTAACTAGAGACAGACCAAC
Reverse Primer: Z6065_R GGCTTGAGGTTTGTGAGAACC
Reviews

Customers who bought this product also purchased
Z7515
Z7515
FGC15772
FGC15772
J2a-L24 Panel
J2a-L24 Panel
Z27932
Z27932
Y89588
Y89588
Y16826
Y16826
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies