Top » Catalog » SNPs » Z6065

$18.00

Z6065
[Z6065]

Z6065
hg38 Position: ChrY:16070426..16070426
Ancestral: G
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: J2a1a2a1
Comments: Approx. L267
Forward Primer: Z6065_F CACTTTCCTAACTAGAGACAGACCAAC
Reverse Primer: Z6065_R GGCTTGAGGTTTGTGAGAACC
Reviews

Customers who bought this product also purchased
M172
M172
M267
M267
M9
M9
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Y23722
Y23722
Y23726
Y23726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18435
$18.00
Haplogroup Info
Other products
Currencies