Top » Catalog » SNPs » Z6065

$18.00

Z6065
[Z6065]

Z6065
hg38 Position: ChrY:16070426..16070426
Ancestral: G
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: J2a1a2a1
Comments: Approx. L267
Forward Primer: Z6065_F CACTTTCCTAACTAGAGACAGACCAAC
Reverse Primer: Z6065_R GGCTTGAGGTTTGTGAGAACC
Reviews

Customers who bought this product also purchased
Z7553
Z7553
Z7503
Z7503
FGC15901
FGC15901
ZS7528
ZS7528
FGC15895
FGC15895
M172
M172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies