Top » Catalog » SNPs » L1402

$18.00

L1402
[L1402]

L1402
hg38 Position: ChrY:3019238..3019238
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1g2a1a3a
Comments: Found in a hg R-DF21 WTY participant
Forward Primer: L1402_F GAAAGGCAGCCAAGAGGAC
Reverse Primer: L1402_R TGTCTTACCTAATTCTAAGCAAGGC
Reviews

Customers who bought this product also purchased
FGC3903
FGC3903
S5488
S5488
A418
A418
DF5
DF5
A5409
A5409
FGC3213
FGC3213
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies