Top » Catalog » SNPs » L1403

$18.00

L1403
[L1403]

L1403
hg38 Position: ChrY:20587901..20587901
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1g2a1a3
Comments: Found in a hg R-DF21 WTY participant
Forward Primer: L1403_F CACTGTGCTTGCCTTTTGTG
Reverse Primer: L1403_R AAGCTCGCCATATGCCTTC
Reviews

Customers who bought this product also purchased
S3781
S3781
S971
S971
Z39589
Z39589
FGC15498
FGC15498
BY9596
BY9596
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies