Top » Catalog » SNPs » S16264

$18.00

S16264
[S16264]

S16264
hg38 Position: ChrY:12546831..12546831
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1m
Comments: Approx. L679
Forward Primer: S16264_F GAACACACGACCACACCTACTAAC
Reverse Primer: S16264_R ATCAGGCAGAGCTCAGCAG
Reviews

Customers who bought this product also purchased
DF27
DF27
Y18437
Y18437
R1b-DF27 Panel
R1b-DF27 Panel
Y18513
Y18513
BY3927
BY3927
A7907
A7907
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies