Top » Catalog » SNPs » A148

$18.00

A148
[A148]

A148
hg38 Position: ChrY:9240658..9240658
Ancestral: T
Derived: A
Reference: YFull (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Aka YFS066623 found in a R1b-L371 person
Forward Primer: A148_F TTGCAACTGTCTTCACTGCAG
Reverse Primer: A148_R CTATGGGAGACTGGGCCTC
Reviews

Customers who bought this product also purchased
FGC10065
FGC10065
FGC10083
FGC10083
FGC10051
FGC10051
FGC10062
FGC10062
FGC10081
FGC10081
FGC10048
FGC10048
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies