Top » Catalog » SNPs » Y15850

$18.00

Y15850
[Y15850]

Y15850
hg38 Position: ChrY:7235820..7235820
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: R1b
Comments: Below DF27 > A431 > Y7363 > Y15640
Forward Primer: Y15850_F CCTGGGTTTGTAGCTTGGG
Reverse Primer: Y15850_R TGACGGAGTTATGCAAAAGAAG
Reviews

Customers who bought this product also purchased
A447
A447
A5579
A5579
A435
A435
Wish a SNP
Wish a SNP
A444
A444
A455
A455
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies