Top » Catalog » SNPs » Y15850

$18.00

Y15850
[Y15850]

Y15850
hg38 Position: ChrY:7235820..7235820
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: R1b
Comments: Below DF27 > A431 > Y7363 > Y15640
Forward Primer: Y15850_F CCTGGGTTTGTAGCTTGGG
Reverse Primer: Y15850_R TGACGGAGTTATGCAAAAGAAG
Reviews

Customers who bought this product also purchased
A442
A442
A450
A450
A446
A446
A441
A441
A451
A451
A5580
A5580
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies