Top » Catalog » SNPs » A28755

$18.00

A28755
[A28755]

A28755
hg38 Position: ChrY:7764803..7764803
Ancestral: A
Derived: G
Reference: YSEQ (2021)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A28755_F ACATGAAAAAATGCTCATCATTG
Reverse Primer: A28755_R TGTTGGTTTGCTACACACATCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies