Top » Catalog » SNPs » Y49000

$18.00

Y49000
[Y49000]

Y49000
hg38 Position: ChrY:11982015..11982015
Ancestral: A
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: N
Comments: .
Forward Primer: Y49000_F CATCAGGTGTTCCTTAGTCCCTAG
Reverse Primer: Y49000_R AGGTAGGCAGGCAGATAGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS490
$11.00
Haplogroup Info
Other products
Currencies