Top » Catalog » SNPs » Y73542

$18.00

Y73542
[Y73542]

Y73542
hg38 Position: ChrY:16310297..16310297
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: I2a
Comments: Below L621 > CTS10228 > Y70430
Forward Primer: Y73542_F GGGCATTTGAATGTTCTAAGGTG
Reverse Primer: Y73542_R TGATTGGTGCGTTTACAATCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies