Top » Catalog » SNPs » FGC56230

$18.00

FGC56230
[FGC56230]

FGC56230
hg38 Position: ChrY:16807816..16807816
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R2
Comments: Below Y8763 > L295 > FGC56225
Forward Primer: FGC56230_F ACTGGGCTAAGGGATATCCTG
Reverse Primer: FGC56230_R GATCCATCAAGTGCAGGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies