Top » Catalog » SNPs » Y22512

$18.00

Y22512
[Y22512]

Y22512
hg38 Position: ChrY:19521125..19521125
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: R1b
Comments: Below U106 > L48 > Z159 > CTS13009
Forward Primer: Y22512_F TAGCACAGTGAGGCCAAGTG
Reverse Primer: Y22512_R GGAGTCCAGGTCTGCTTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies