Top » Catalog » SNPs » Y10541

$18.00

Y10541
[Y10541]

Y10541
hg38 Position: ChrY:7112361..7112361
Ancestral: A
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: E1b
Comments: Below L19 > PF2438
Forward Primer: Y10541_F GAATTAACTGGCATGTGTCTACTCTG
Reverse Primer: Y10541_R ACTAAGTATCTCTACCACTGGGATACCT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies