Top » Catalog » SNPs » FT243046

$18.00

FT243046
[FT243046]

FT243046
hg38 Position: ChrY:13748904..13748904
Ancestral: A
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: E1b
Comments: Below M81 > PF2546 > A930 > MZ244 > FT243964
Forward Primer: FT243046_F TTAAGTAAAACCAATGTCAGCGTAAG
Reverse Primer: FT243046_R AGTTATTAAAAGGAAACTTGGGCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies