Top » Catalog » SNPs » Y95937

$18.00

Y95937
[Y95937]

Y95937
hg38 Position: ChrY:14199997..14199997
Ancestral: G
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: Below Z284 > L448 > YP4252 > BY30796
Forward Primer: Y95937_F GTTCAACATTCCAATACAAAATCG
Reverse Primer: Y95937_R ACCTCCCCTCCTGGGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies