Top » Catalog » SNPs » MZ232

$18.00

MZ232
[MZ232]

MZ232
hg38 Position: ChrY:21122214..21122214
Ancestral: A
Derived: C
Reference: Hamma Bachir (2017)
ISOGG Haplogroup: E1b
Comments: Downstream of Z5009
Forward Primer: MZ232_F GGCTTTACTACTGCCATTGGTC
Reverse Primer: MZ232_R TGAAGTCTCACTCTGTTGCCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies