Top » Catalog » SNPs » F19788

$18.00

F19788
[F19788]

F19788
hg38 Position: ChrY:13319893..13319893
Ancestral: A
Derived: T
Reference: Ryan Lan-Hai Wei (2017)
ISOGG Haplogroup: O
Comments: Below M268 > PK4 > F838
Forward Primer: F19788_F GGGACAATTTTGAAAGATAAGAGAAAC
Reverse Primer: F19788_R GACAATGCTTCCTATAGAATTCTTACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies