Top » Catalog » SNPs » BY155734

$18.00

BY155734
[BY155734]

BY155734
hg38 Position: ChrY:21859562..21859562
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY155734_F ACCCACAGAAAAGAGAGGTGG
Reverse Primer: BY155734_R GAGACACTGTCTCAACCTCATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies