Top » Catalog » SNPs » A25334

$18.00

A25334
[A25334]

A25334
hg38 Position: ChrY:8744237..8744237
Ancestral: C
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A25334_F CTTACCTGGGAGAGAGCAATTG
Reverse Primer: A25334_R GGACTAGATCATGGGTATGACCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies