Top » Catalog » SNPs » FT13959

$18.00

FT13959
[FT13959]

FT13959
hg38 Position: ChrY:19962083..19962083
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below M222 > DF105
Forward Primer: FT13959_F TGTGTCTGGAATTGGTTCCC
Reverse Primer: FT13959_R CAGTAGCGGCAACCCATC
Reviews

Customers who bought this product also purchased
BY35728
BY35728
Wish a SNP
Wish a SNP
BY35729
BY35729
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies