Top » Catalog » SNPs » BY35729

$18.00

BY35729
[BY35729]

BY35729
hg38 Position: ChrY:14191737..14191737
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below M222 > DF105
Forward Primer: BY35729_F TCTACAATGCCCAGAAGATGC
Reverse Primer: BY35729_R GGAAAGCAGAGCTGGGGAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
FT13959
FT13959
BY35728
BY35728
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies