Top » Catalog » SNPs » FT169823

$18.00

FT169823
[FT169823]

FT169823
hg38 Position: ChrY:15703321..15703321
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below FGC44555
Forward Primer: FT169823_F CCCTGCCTCAAATCTGGAC
Reverse Primer: FT169823_R ATGAAAGATTTCATAGTCAAAATGTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies