Top » Catalog » SNPs » Z21286

$18.00

Z21286
[Z21286]

Z21286
hg38 Position: ChrY:19163200..19163200
Ancestral: A
Derived: G
Reference: Ray Banks (2015)
ISOGG Haplogroup: E (not listed)
Comments: under V65
Forward Primer: Z21286_F CCTAGAAGAAAACCTAATCAATATCATTTG
Reverse Primer: Z21286_R TGAACTAATTTACCCTACCATCAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies