Top » Catalog » SNPs » YP417

$18.00

YP417
[YP417]

YP417
hg38 Position: ChrY:13756598..13756598
Ancestral: G
Derived: A
Reference: Y community
ISOGG Haplogroup: R1a1a1b1a1b1c
Comments: .
Forward Primer: YP417_F GAGAAATGCCATCCTGGTTC
Reverse Primer: YP417_R AGGAGGCTGTTCGTCTCTTG
Reviews

Customers who bought this product also purchased
Y39054
Y39054
Y139228
Y139228
A27236
A27236
BY82741
BY82741
Y70897
Y70897
BY82357
BY82357
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies