Top » Catalog » SNPs » YP417

$18.00

YP417
[YP417]

YP417
hg38 Position: ChrY:13756598..13756598
Ancestral: G
Derived: A
Reference: Y community
ISOGG Haplogroup: R1a1a1b1a1b1c
Comments: .
Forward Primer: YP417_F GAGAAATGCCATCCTGGTTC
Reverse Primer: YP417_R AGGAGGCTGTTCGTCTCTTG
Reviews

Customers who bought this product also purchased
BY30779
BY30779
BY179631
BY179631
FT168438
FT168438
YP5081
YP5081
Y91231
Y91231
Y96582
Y96582
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies