Top » Catalog » SNPs » YP417

$18.00

YP417
[YP417]

YP417
hg38 Position: ChrY:13756598..13756598
Ancestral: G
Derived: A
Reference: Y community
ISOGG Haplogroup: R1a1a1b1a1b1c
Comments: .
Forward Primer: YP417_F GAGAAATGCCATCCTGGTTC
Reverse Primer: YP417_R AGGAGGCTGTTCGTCTCTTG
Reviews

Customers who bought this product also purchased
A26328
A26328
FGC64564
FGC64564
YSEQ-Alpha
YSEQ-Alpha
YSEQ-Delta
YSEQ-Delta
Y81086
Y81086
Y129780
Y129780
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies