Top » Catalog » SNPs » FGC440

$18.00

FGC440
[FGC440]

FGC440
hg38 Position: ChrY:2800666..2800666
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a PF1169 sample
Forward Primer: FGC440_F GCATTAGCGGGGTGATAGTC
Reverse Primer: FGC440_R CCAAGTAACTGGCATTACAGGG
Reviews

Customers who bought this product also purchased
Z2980
Z2980
FGC12950
FGC12950
A359
A359
S588
S588
DF49
DF49
R1b-PF1169 panel
R1b-PF1169 panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies