Top » Catalog » SNPs » FT176119

$18.00

FT176119
[FT176119]

FT176119
hg38 Position: ChrY:14966116..14966116
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FT176119_F TAAAATTTCAAATCTCACACATGACAC
Reverse Primer: FT176119_R GCTTTTTGTAGCCATGATAAAGTACTAC
Reviews

Customers who bought this product also purchased
FT175994
FT175994
FT174826
FT174826
Wish a SNP
Wish a SNP
FT176384
FT176384
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies