Top » Catalog » SNPs » FGC454

$18.00

FGC454
[FGC454]

FGC454
hg38 Position: ChrY:15291214..15291214
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a PF1169 sample
Forward Primer: FGC454_F GTGTGCACAGATCCACGGT
Reverse Primer: FGC454_R GGAGAAATTACCTGCGAATCC
Reviews

Customers who bought this product also purchased
R1b-PF1169 panel
R1b-PF1169 panel
S563
S563
S556
S556
S562
S562
S567
S567
S555
S555
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies