Top » Catalog » SNPs » FGC461

$18.00

FGC461
[FGC461]

FGC461
hg38 Position: ChrY:20375818..20375818
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a PF1169 sample
Forward Primer: FGC461_F AAAATTTAAAAGGCAGTCAGCAG
Reverse Primer: FGC461_R TGCTTTCACCTTTTGTATTTCAC
Reviews

Customers who bought this product also purchased
R1b-PF1169 panel
R1b-PF1169 panel
S556
S556
S562
S562
S567
S567
S555
S555
S560
S560
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies