Top » Catalog » SNPs » BY102150

$18.00

BY102150
[BY102150]

BY102150
hg38 Position: ChrY:13404785..13404785
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: BY102150_F AGGATGAAAAGTGGCAATCTG
Reverse Primer: BY102150_R CACACACACATATGTACACATATATATCGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies